nordiag

GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research–an update.

GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research–an update.

GenAlEx: Genetic Analysis in Excel is a cross-platform package for population genetic analyses that runs within Microsoft Excel. GenAlEx offers analysis of diploid codominant, haploid and binary genetic loci and DNA sequences. Both frequency-based (F-statistics, heterozygosity, HWE, population assignment, relatedness) and distance-based (AMOVA, PCoA, Mantel tests, multivariate spatial autocorrelation) analyses are provided.
New features include calculation of new estimators of population structure: G'(ST), G”(ST), Jost’s D(est) and F'(ST) through AMOVA, Shannon Information analysis, linkage disequilibrium analysis for biallelic data and novel heterogeneity tests for spatial autocorrelation analysis. Export to more than 30 other data formats is provided. Teaching tutorials and expanded step-by-step output options are included. The comprehensive guide has been fully revised.
METHODS
GenAlEx is written in VBA and provided as a Microsoft Excel Add-in (compatible with Excel 2003, 2007, 2010 on PC; Excel 2004, 2011 on Macintosh). GenAlEx, and supporting documentation and tutorials are freely available at: http://biology.anu

nordiag

Site-directed mutagenesis by overlap extension using the polymerase chain reaction.

Overlap extension represents a new approach to genetic engineering. Complementary oligodeoxyribonucleotide (oligo) primers and the polymerase chain reaction are used to generate twoDNA fragments having overlapping ends. These fragments are combined in a subsequent ‘fusion’ reaction in which the overlapping ends anneal, allowing the 3′ overlap of each strand to serve as a primer for the 3′ extension of the complementary strand. The resulting fusion product is amplified further by PCR.
Specific alterations in the nucleotide (nt) sequence can be introduced by incorporating nucleotide changes into the overlapping oligo primers. Using this technique of site-directed mutagenesis, three variants of a mouse major histocompatibility complex class-I gene have been generated, cloned and analyzed. Screening of mutant clones revealed at least a 98% efficiency of mutagenesis. All clones sequenced contained the desired mutations, and a low frequency of random substitution estimated to occur at approx. 1 in 4000 nt was detected. This method represents a significant improvement over standard methods of site-directed mutagenesis because it is much faster, simpler and approaches 100% efficiency in the generation of mutant product.

Crystal structure of the nucleosome core particle at 2.8 A resolution.

The X-ray crystal structure of the nucleosome core particle of chromatin shows in atomic detail how the histone protein octamer is assembled and how 146 base pairs of DNA are organized into a superhelix around it. Both histone/histone and histone/DNA interactions depend on the histone fold domains and additional, well ordered structure elements extending from this motif.
Histone amino-terminal tails pass over and between the gyres of the DNA superhelix to contact neighbouring particles. The lack of uniformity between multiple histone/DNA-binding sites causes the DNA to deviate from ideal superhelix geometry.

Base-calling of automated sequencer traces using phred. I. Accuracy assessment.

The availability of massive amounts of DNA sequence information has begun to revolutionize the practice of biology. As a result, current large-scale sequencing output, while impressive, is not adequate to keep pace with growing demand and, in particular, is far short of what will be required to obtain the 3-billion-base human genome sequence by the target date of 2005.
To reach this goal, improved automation will be essential, and it is particularly important that human involvement in sequence data processing be significantly reduced or eliminated. Progress in this respect will require both improved accuracy of the data processing software and reliable accuracy measures to reduce the need for human involvement in error correction and make human review more efficient. Here, we describe one step toward that goal: a base-calling program for automated sequencer traces, phred, with improved accuracy. phred appears to be the first base-calling program to achieve a lower error rate than the ABI software, averaging 40%-50% fewer errors in the data sets examined independent of position in read, machine running conditions, or sequencing chemistry.

The language of covalent histone modifications

Histone proteins and the nucleosomes they form with DNA are the fundamental building blocks of eukaryotic chromatin. A diverse array of post-translational modifications that often occur on tail domains of these proteins has been well documented.
Although the function of these highly conserved modifications has remained elusive, converging biochemical and genetic evidence suggests functions in several chromatin-based processes. We propose that distinct histone modifications, on one or more tails, act sequentially or in combination to form a ‘histone code’ that is, read by other proteins to bring about distinct downstream events.

UCHIME improves sensitivity and speed of chimera detection

BACKGROUND
Chimeric DNA sequences often form during polymerase chain reaction amplification, especially when sequencing single regions (e.g. 16S rRNA or fungal Internal Transcribed Spacer) to assess diversity or compare populations. Undetected chimeras may be misinterpreted as novel species, causing inflated estimates of diversity and spurious inferences of differences between populations. Detection and removal of chimeras is therefore of critical importance in such experiments.
RESULTS
We describe UCHIME, a new program that detects chimeric sequences with two or more segments. UCHIME either uses a database of chimera-free sequences or detects chimeras de novo by exploiting abundance data.
UCHIME has better sensitivity than ChimeraSlayer (previously the most sensitive database method), especially with short, noisy sequences. In testing on artificial bacterial communities with known composition, UCHIME de novo sensitivity is shown to be comparable to Perseus. UCHIME is >100× faster than Perseus and >1000× faster than ChimeraSlayer.
BACKGROUND
robert@drive5.com
BACKGROUND
Source, binaries and data: http://drive5.com/uchime.
BACKGROUND
Supplementary data are available at Bioinformatics online.
Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
RDR-CCR6-Hu-96Tests 96 Tests
EUR 756
Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
RD-CCR6-Hu-48Tests 48 Tests
EUR 521
Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
RD-CCR6-Hu-96Tests 96 Tests
EUR 723
Anti-CCR6/CCR6 Antibody
PA1201 100ug/vial
EUR 294
CCR6
MO15087 100 ug
EUR 409
CCR6 antibody
70R-13797 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal CCR6 antibody
CCR6 Antibody
37466-100ul 100ul
EUR 252
CCR6 antibody
10R-1071 100 ul
EUR 316
Description: Mouse monoclonal CCR6 antibody
CCR6 Antibody
1-CSB-PA004845EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000
CCR6 Antibody
1-CSB-PA943255
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200
CCR6 Antibody
DF10207 200ul
EUR 304
Description: CCR6 Antibody detects endogenous levels of total CCR6.
CCR6 Antibody
1-CSB-PA244343
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200
CCR6 siRNA
20-abx910877
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CCR6 siRNA
20-abx910878
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CCR6 Antibody
ABD10207 100 ug
EUR 438
CCR6 Rabbit pAb
A16206-100ul 100 ul
EUR 308
CCR6 Rabbit pAb
A16206-200ul 200 ul
EUR 459
CCR6 Rabbit pAb
A16206-20ul 20 ul
EUR 183
CCR6 Rabbit pAb
A16206-50ul 50 ul
EUR 223
CCR6 Blocking Peptide
DF10207-BP 1mg
EUR 195
Anti-CCR6 Antibody
A00957 100ug/vial
EUR 334
Anti-CCR6 Antibody
A00061-1 200ug
EUR 397
Description: Goat Polyclonal CCR6 Antibody. Validated in ELISA, IHC and tested in Human, Mouse.
CCR6 Blocking Peptide
20-abx061923
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
CCR6 Conjugated Antibody
C37466 100ul
EUR 397
CCR6 cloning plasmid
CSB-CL004845HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1125
  • Sequence: atgagcggggaatcaatgaatttcagcgatgttttcgactccagtgaagattattttgtgtcagtcaatacttcatattactcagttgattctgagatgttactgtgctccttgcaggaggtcaggcagttctccaggctatttgtaccgattgcctactccttgatctgtgtct
  • Show more
Description: A cloning plasmid for the CCR6 gene.
CCR6 Polyclonal Antibody
A50105 100 µg
EUR 570.55
Description: kits suitable for this type of research
CCR6 inhibitor 1
HY-112701 10mg
EUR 911
Anti-CCR6 antibody
STJ118659 100 µl
EUR 277
Anti-CCR6 Antibody
STJ500414 100 µg
EUR 476
CCR6 Antibody, HRP conjugated
1-CSB-PA004845EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CCR6 Antibody, FITC conjugated
1-CSB-PA004845EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CCR6 Antibody, Biotin conjugated
1-CSB-PA004845ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human CCR6 ELISA Kit
ELA-E2014h 96 Tests
EUR 824
CCR6 ELISA KIT|Human
EF006138 96 Tests
EUR 689
Mouse CCR6 shRNA Plasmid
20-abx969534
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CCR6 shRNA Plasmid
20-abx950871
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CCR6 Recombinant Protein (Human)
RP006232 100 ug Ask for price
CCR6 Recombinant Protein (Rat)
RP193790 100 ug Ask for price
CCR6 Recombinant Protein (Mouse)
RP122255 100 ug Ask for price
CCR6 Recombinant Protein (Mouse)
RP122258 100 ug Ask for price
CCR6 Recombinant Protein (Mouse)
RP122261 100 ug Ask for price
CCR6 Recombinant Protein (Mouse)
RP122264 100 ug Ask for price
CCR6 Recombinant Protein (Mouse)
RP122267 100 ug Ask for price
CCR6 Recombinant Protein (Mouse)
RP122270 100 ug Ask for price
CCR6 Recombinant Protein (Mouse)
RP122273 100 ug Ask for price
Anti-CCR6 Antibody (Biotin)
STJ500416 100 µg
EUR 586
Anti-CCR6 Antibody (FITC)
STJ500417 100 µg
EUR 586
cDNA Synthesis SuperMix
20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
Evo? cDNA Kit
M1164-100
EUR 294
Evo? cDNA Kit
M1164-25
EUR 234
Novo? cDNA Kit
M1165-100
EUR 354
Novo? cDNA Kit
M1165-25
EUR 267
Evo? cDNA Supermix
M1168-100
EUR 381
Evo? cDNA Supermix
M1168-25
EUR 267
Novo? cDNA Supermix
M1169-100
EUR 441
Novo? cDNA Supermix
M1169-25
EUR 289
Polyclonal CCR6 Antibody (C-Terminus)
APR15281G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCR6 (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal CCR6 Antibody (Cytoplasmic Domain)
APR15282G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCR6 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal CCR6 Antibody (Extracellular Domain)
APR15283G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCR6 (Extracellular Domain). This antibody is tested and proven to work in the following applications:
Polyclonal CCR6 Antibody (aa18-46)
APR15308G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CCR6 (aa18-46). This antibody is tested and proven to work in the following applications:
CCR6 Polyclonal Antibody, HRP Conjugated
A50106 100 µg
EUR 570.55
Description: fast delivery possible
CCR6 Polyclonal Antibody, FITC Conjugated
A50107 100 µg
EUR 570.55
Description: reagents widely cited
CCR6 Polyclonal Antibody, Biotin Conjugated
A50108 100 µg
EUR 570.55
Description: Ask the seller for details
Ccr6 ORF Vector (Rat) (pORF)
ORF064598 1.0 ug DNA
EUR 506
h CCR6 inducible lentiviral particles
LVP513 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made optional inducible lentiviral particles for expressing human target: h CCR6 inducible lentiviral particles (alternative name: BN-1, C-C CKR-6, CC-CKR-6, CCR-6, CD196, CKR-L3, CKRL3, CMKBR6, DCR2, DRY6, GPR29, GPRCY4, STRL22). The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_004367.5. Particles also contains a RFP-Blasticidin dual selection marker.
CCR6 ORF Vector (Human) (pORF)
ORF002078 1.0 ug DNA
EUR 95
Ccr6 ORF Vector (Mouse) (pORF)
ORF040753 1.0 ug DNA
EUR 506
Ccr6 ORF Vector (Mouse) (pORF)
ORF040754 1.0 ug DNA
EUR 506
Ccr6 ORF Vector (Mouse) (pORF)
ORF040755 1.0 ug DNA
EUR 506
Ccr6 ORF Vector (Mouse) (pORF)
ORF040756 1.0 ug DNA
EUR 506
Ccr6 ORF Vector (Mouse) (pORF)
ORF040757 1.0 ug DNA
EUR 506
Ccr6 ORF Vector (Mouse) (pORF)
ORF040758 1.0 ug DNA
EUR 506
Ccr6 ORF Vector (Mouse) (pORF)
ORF040759 1.0 ug DNA
EUR 506
pECMV-Ccr6-m-FLAG Plasmid
PVT14903 2 ug
EUR 325
pECMV-Ccr6-m-FLAG Plasmid
PVT15327 2 ug
EUR 325
CCR6 ELISA Kit (Human) (OKAN05540)
OKAN05540 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL
CCR6 ELISA Kit (Human) (OKCD07908)
OKCD07908 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL
CCR6 ELISA Kit (Mouse) (OKCD07909)
OKCD07909 96 Wells
EUR 1001
Description: Description of target: Receptor for the C-C type chemokine CCL20. Binds to CCL20 and subsequently transduces a signal by increasing the intracellular calcium ion levels (PubMed:20068036). Although CCL20 is its major ligand it can also act as a receptor for non-chemokine ligands such as beta-defensins (PubMed:25122636). Binds to defensin DEFB1 leading to increase in intracellular calcium ions and cAMP levels. Its binding to DEFB1 is essential for the function of DEFB1 in regulating sperm motility and bactericidal activity. Binds to defensins DEFB4 and DEFB4A/B and mediates their chemotactic effects (PubMed:20068036). The ligand-receptor pair CCL20-CCR6 is responsible for the chemotaxis of dendritic cells (DC), effector/memory T-cells and B-cells and plays an important role at skin and mucosal surfaces under homeostatic and inflammatory conditions, as well as in pathology, including cancer and various autoimmune diseases. CCR6-mediated signals are essential for immune responses to microbes in the intestinal mucosa and in the modulation of inflammatory responses initiated by tissue insult and trauma (PubMed:21376174). CCR6 is essential for the recruitment of both the proinflammatory IL17 producing helper T-cells (Th17) and the regulatory T-cells (Treg) to sites of inflammation (PubMed:19050256). Required for the normal migration of Th17 cells in Peyers patches and other related tissue sites of the intestine and plays a role in regulating effector T-cell balance and distribution in inflamed intestine (PubMed:19129757). Plays an important role in the coordination of early thymocyte precursor migration events important for normal subsequent thymocyte precursor development, but is not required for the formation of normal thymic natural regulatory T-cells (nTregs). Required for optimal differentiation of DN2 and DN3 thymocyte precursors (PubMed:24638065). Essential for B-cell localization in the subepithelial dome of Peyers-patches and for efficient B-cell isotype switching to IgA in the Peyers-patches (PubMed:27174992). Essential for appropriate anatomical distribution of memory B-cells in the spleen and for the secondary recall response of memory B-cells (PubMed:25505290). Positively regulates sperm motility and chemotaxis via its binding to CCL20 (PubMed:23765988).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.053ng/mL
CCR6 ELISA Kit (Mouse) (OKEH03436)
OKEH03436 96 Wells
EUR 662
Description: Description of target: Receptor for the C-C type chemokine CCL20. Binds to CCL20 and subsequently transduces a signal by increasing the intracellular calcium ion levels (PubMed:20068036). Although CCL20 is its major ligand it can also act as a receptor for non-chemokine ligands such as beta-defensins (PubMed:25122636). Binds to defensin DEFB1 leading to increase in intracellular calcium ions and cAMP levels. Its binding to DEFB1 is essential for the function of DEFB1 in regulating sperm motility and bactericidal activity. Binds to defensins DEFB4 and DEFB4A/B and mediates their chemotactic effects (PubMed:20068036). The ligand-receptor pair CCL20-CCR6 is responsible for the chemotaxis of dendritic cells (DC), effector/memory T-cells and B-cells and plays an important role at skin and mucosal surfaces under homeostatic and inflammatory conditions, as well as in pathology, including cancer and various autoimmune diseases. CCR6-mediated signals are essential for immune responses to microbes in the intestinal mucosa and in the modulation of inflammatory responses initiated by tissue insult and trauma (PubMed:21376174). CCR6 is essential for the recruitment of both the proinflammatory IL17 producing helper T-cells (Th17) and the regulatory T-cells (Treg) to sites of inflammation (PubMed:19050256). Required for the normal migration of Th17 cells in Peyers patches and other related tissue sites of the intestine and plays a role in regulating effector T-cell balance and distribution in inflamed intestine (PubMed:19129757). Plays an important role in the coordination of early thymocyte precursor migration events important for normal subsequent thymocyte precursor development, but is not required for the formation of normal thymic natural regulatory T-cells (nTregs). Required for optimal differentiation of DN2 and DN3 thymocyte precursors (PubMed:24638065). Essential for B-cell localization in the subepithelial dome of Peyers-patches and for efficient B-cell isotype switching to IgA in the Peyers-patches (PubMed:27174992). Essential for appropriate anatomical distribution of memory B-cells in the spleen and for the secondary recall response of memory B-cells (PubMed:25505290). Positively regulates sperm motility and chemotaxis via its binding to CCL20 (PubMed:23765988).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092 ng/mL
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
SEC014Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chemokine C-C-Motif Receptor 6 (CCR6) in tissue homogenates, cell lysates and other biological fluids.
Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
SEC014Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chemokine C-C-Motif Receptor 6 (CCR6) in tissue homogenates, cell lysates and other biological fluids.
Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
SEC014Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chemokine C-C-Motif Receptor 6 (CCR6) in tissue homogenates, cell lysates and other biological fluids.
Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
SEC014Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chemokine C-C-Motif Receptor 6 (CCR6) in tissue homogenates, cell lysates and other biological fluids.
Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
4-SEC014Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Chemokine C-C-Motif Receptor 6 elisa. Alternative names of the recognized antigen: CD196
  • BN-1
  • CKR-L3
  • CKR6
  • CKRL3
  • CMKBR6
  • DCR2
  • DRY-6
  • GPR-CY4
  • GPR29
  • GPRCY4
  • STRL22
  • Chemokine receptor-like 3
  • LARC receptor
  • G-protein coupled recept
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Chemokine C-C-Motif Receptor 6 (CCR6) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
SEC014Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
SEC014Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
SEC014Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
SEC014Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
4-SEC014Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Chemokine C-C-Motif Receptor 6 elisa. Alternative names of the recognized antigen: CD196
  • BN-1
  • CKR-L3
  • CKR6
  • CKRL3
  • CMKBR6
  • DCR2
  • DRY-6
  • GPR-CY4
  • GPR29
  • GPRCY4
  • STRL22
  • Chemokine receptor-like 3
  • LARC receptor
  • G-protein coupled recept
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA Probe Diluent Solution
AR0063 5mL
EUR 106
cDNA from Arteriosclerosis: Aorta
C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Artery
C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Arteriosclerosis: Artery
C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Vein
C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Colon
C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Heart
C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Heart
C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Kidney
C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Kidney
C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Liver
C1236149Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Asthma: Lung
C1236152Ld-1 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Bronchitis: Lung
C1236152Ld-2 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Emphysema: Lung
C1236152Ld-3 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Pneumonia: Lung
C1236152Ld-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Lung
C1236152Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Pancreas
C1236188Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Spleen
C1236246Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: stomach
C1236248Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Tetro cDNA Synthesis Kit
BIO-65042 30 Reactions Ask for price
Tetro cDNA Synthesis Kit
BIO-65043 100 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053 50 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053/S Sample Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65054 250 Reactions Ask for price
OneScriptPlus cDNA Synthesis Kit
G235 25 x 20 ul reactions
EUR 97
OneScriptPlus cDNA Synthesis Kit
G236 100 x 20 ul reactions
EUR 169
OneScriptPlus cDNA Synthesis SuperMix
G453 25 x 20 ul reactions
EUR 97
OneScriptPlus cDNA Synthesis SuperMix
G454 100 x 20 ul reactions
EUR 169
circRNA cDNA Synthesis Kit
G627 25 rxn (20 ul/rxn)
EUR 309
Human eNOS cDNA probe
eNOS51-D-2 2 ug
EUR 445
Novo? Transcriptome cDNA Kit
M1167-100
EUR 952
Novo? Transcriptome cDNA Kit
M1167-25
EUR 441
Plant Tissue cDNA: Arabidopsis
PC34-310 10 rxn
EUR 415
CCR6 sgRNA CRISPR Lentivector set (Human)
K0395201 3 x 1.0 ug
EUR 339
Ccr6 sgRNA CRISPR Lentivector set (Rat)
K7215601 3 x 1.0 ug
EUR 339
Ccr6 sgRNA CRISPR Lentivector set (Mouse)
K4422401 3 x 1.0 ug
EUR 339
cDNA Synthesis SuperMix for qPCR
20-abx09801920ulSystems
  • EUR 690.00
  • EUR 565.00
  • 100 rxns ×20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
cDNA from Alzheimer's Disease: Brain
C1236035Alz 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Liver Cirrhosis: Brain
C1236035Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Parkinson's Disease: Brain
C1236035Par 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Dementia: Brain: Hippocampus
C1236052Dem 40 reactions
EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Depression: Brain: Hippocampus
C1236052Dep 40 reactions
EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Liver Cirrhosis: Colon
C1236090Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Liver Cirrhosis: Esophagus
C1236106Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Liver Cirrhosis: Heart
C1236122Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Interventricular Septum
C1236130Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Liver Cirrhosis: Kidney
C1236142Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Liver Cirrhosis: Liver
C1236149Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Liver Cirrhosis: Lung
C1236152Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Pulmonary Embolism: Lung
C1236152Ld-5 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Liver Cirrhosis: Diaphragm
C1236169Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Liver Cirrhosis: Pancreas
C1236188Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Liver Cirrhosis: Skin
C1236218Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Small Intestine
C1236226Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Spinal Cord
C1236234Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Liver Cirrhosis: Spleen
C1236246Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Human Tumor Tissue: Breast cDNA
HT05-090 10 rxn
EUR 415
Human Adult cDNA Tissue: Lung
HA-152 10 rxn
EUR 415
Human Adult cDNA Tissue: Skin
HA-218 10 rxn
EUR 415
Human Adult cDNA Tissue: Testis
HA-260 10 rxn
EUR 415
Total-Transcriptome cDNA Synthesis Kit
G904 25 reactions
EUR 224
Total-Transcriptome cDNA Synthesis Kit
G905 100 reactions
EUR 544
Mouse iNOS (macrophage) cDNA probe
iNOS61-D-2 2 ug
EUR 445
Evo? cDNA Kit (gDNA Removal)
M1166-100
EUR 381
Monkey (Rhesus) cDNA Tissue: Thyroid
MR34-265 10 rxn
EUR 415
Accuris qMax cDNA Synthesis Kit
PR2100-C-100 1 PC
EUR 337.75
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
Accuris qMax cDNA Synthesis Kit
PR2100-C-25 1 PC
EUR 142.36
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
Accuris qMax cDNA Synthesis Kit
PR2100-C-250 1 PC
EUR 711.77
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
Accuris qMax cDNA Synthesis Kit
PR2100-C-S 1 PC
EUR 77.76
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
amfiRivert cDNA Synthesis Master Mix
R5101-050 50 rxns
EUR 415
amfiRivert cDNA Synthesis Master Mix
R5101-100 2X50 rxns
EUR 847
amfiRivert cDNA Synthesis Master Mix
R5101-200 4X50 rxns
EUR 1211
amfiRivet cDNA Synthesis 2X Buffer
R5102-050 500ul
EUR 134
amfiRivet cDNA Synthesis 2X Buffer
R5102-100 2x500ul
EUR 192
CCR6 sgRNA CRISPR Lentivector (Human) (Target 1)
K0395202 1.0 ug DNA
EUR 154
CCR6 sgRNA CRISPR Lentivector (Human) (Target 2)
K0395203 1.0 ug DNA
EUR 154
CCR6 sgRNA CRISPR Lentivector (Human) (Target 3)
K0395204 1.0 ug DNA
EUR 154
Ccr6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7215602 1.0 ug DNA
EUR 154
Ccr6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7215603 1.0 ug DNA
EUR 154
Ccr6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7215604 1.0 ug DNA
EUR 154
Ccr6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4422402 1.0 ug DNA
EUR 154
Ccr6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4422403 1.0 ug DNA
EUR 154
Tags: , , , , , , ,