A framework for variation discovery and genotyping using next-generation DNA sequencing data.

Recent advances in sequencing technology make it possible to comprehensively catalog genetic variation in population samples, creating a foundation for understanding human disease, ancestry and evolution. The amounts of raw data produced are prodigious, and many computational steps are required to translate this output into high-quality variant calls. We present a unified analytic framework to discover and genotype variation among multiple samples simultaneously that achieves sensitive and specific results across five sequencing technologies and three distinct, canonical experimental designs.

Our process includes (i) initial read mapping; (ii) local realignment around indels; (iii) base quality score recalibration; (iv) SNP discovery and genotyping to find all potential variants; and (v) machine learning to separate true segregating variation from machine artifacts common to next-generation sequencing technologies. We here discuss the application of these tools, instantiated in the Genome Analysis Toolkit, to deep whole-genome, whole-exome capture and multi-sample low-pass (∼4×) 1000 Genomes Project datasets.

Navy RNA Lysis Kit 50
NAVYE1-RNA	Next Advance	50pack	EUR 198
Description: Bead lysis kits for the homogenization of large, tough samples. Pack of 50, 1.5mL Eppendorf Safe-Lock tubes prefilled with stainless steel beads. RNase free.

Navy RNA Lysis Kit 250
NAVYE5-RNA	Next Advance	250pack	EUR 651
Description: Bead lysis kits for the homogenization of large, tough samples. Pack of 250, 1.5mL Eppendorf Safe-Lock tubes prefilled with stainless steel beads. RNase free.

Pink RNA Lysis Kit 50
PINKE1-RNA	Next Advance	50pack	EUR 178
Description: Bead lysis kits for the homogenization of small, soft or medium-tough samples. Pack of 50, 1.5mL Eppendorf Safe-Lock tubes prefilled with stabilized ceramic beads. RNase free.

Pink RNA Lysis Kit 250
PINKE5-RNA	Next Advance	250pack	EUR 561
Description: Bead lysis kits for the homogenization of small, soft or medium-tough samples. Pack of 250, 1.5mL Eppendorf Safe-Lock tubes prefilled with stabilized ceramic beads. RNase free.

Red RNA Lysis Kit 50
REDE1-RNA	Next Advance	50pack	EUR 192
Description: Bead lysis kits for the homogenization of large, soft or medium-tough samples. Pack of 50, 1.5mL Eppendorf Safe-Lock tubes prefilled with stabilized ceramic beads. RNase free.

Red RNA Lysis Kit 250
REDE5-RNA	Next Advance	250pack	EUR 622
Description: Bead lysis kits for the homogenization of large, soft or medium-tough samples. Pack of 250, 1.5mL Eppendorf Safe-Lock tubes prefilled with stabilized ceramic beads. RNase free.

YELLOW RNA Lysis Kit 50
YELLOWE1-RNA	Next Advance	50pack	EUR 192
Description: Bead lysis kits for the homogenization of small cell suspensions (ex - E. coli). Pack of 50, 1.5mL Eppendorf Safe-Lock tubes prefilled with stabilized ceramic beads. RNase free.

YELLOW RNA Lysis Kit 250
YELLOWE5-RNA	Next Advance	250pack	EUR 624
Description: Bead lysis kits for the homogenization of small cell suspensions (ex - E. coli). Pack of 250, 1.5mL Eppendorf Safe-Lock tubes prefilled with stabilized ceramic beads. RNase free.

Cross match determination (FCXM)
FCXM-100T	ImmunoStep	100 test	EUR 671.82

Cross match determination (FCXM)
FCXM-25T	ImmunoStep	25 test	EUR 343.37

Cross match determination (FCXM)
FCXMPU	ImmunoStep	0,5 mg	EUR 516.7

5E GREEN RNA Lysis Kit 100
GREEN5E100-RNA	Next Advance	100pack	EUR 386
Description: Bead lysis kits for the homogenization of small, tough samples. Pack of 1000, 5mL Eppendorf Safe-Lock tubes prefilled with beads. RNase free.

5E GREEN RNA Lysis Kit 20
GREEN5E20-RNA	Next Advance	20pack	EUR 138
Description: Bead lysis kits for the homogenization of small, tough samples. Pack of 20, 5mL Eppendorf Safe-Lock tubes prefilled with beads. RNase free.

Green RINO RNA Lysis Kit 50
GREENR1-RNA	Next Advance	50pack	EUR 184
Description: Bead lysis kits for the homogenization of small, tough samples. Pack of 50, 1.5mL RINO screw-cap tubes prefilled with beads. RNase free.

Green RINO RNA Lysis Kit 250
GREENR5-RNA	Next Advance	250pack	EUR 587
Description: Bead lysis kits for the homogenization of small, tough samples. Pack of 250, 1.5mL RINO screw-cap tubes prefilled with beads. RNase free.

5E Navy RNA Lysis Kit 100
NAVY5E100-RNA	Next Advance	100pack	EUR 453
Description: Bead lysis kits for the homogenization of large, tough samples. Pack of 100, 5mL Eppendorf Safe-Lock tubes prefilled with stainless steel beads. RNase free.

5E Navy RNA Lysis Kit 20
NAVY5E20-RNA	Next Advance	20pack	EUR 153
Description: Bead lysis kits for the homogenization of large, tough samples. Pack of 20, 5mL Eppendorf Safe-Lock tubes prefilled with stainless steel beads. RNase free.

Navy RINO RNA Lysis Kit 50
NAVYR1-RNA	Next Advance	50pack	EUR 202
Description: Bead lysis kits for the homogenization of large, tough samples. Pack of 50, 1.5mL RINO screw-cap tubes prefilled with stainless steel beads. RNase free.

Navy RINO RNA Lysis Kit 250
NAVYR5-RNA	Next Advance	250pack	EUR 666
Description: Bead lysis kits for the homogenization of large, tough samples. Pack of 250, 1.5mL RINO screw-cap tubes prefilled with stainless steel beads. RNase free.

5E PINK RNA Lysis Kit 100
PINK5E100-RNA	Next Advance	100pack	EUR 380
Description: Bead lysis kits for the homogenization of small, soft or medium-tough samples. Pack of 100, 5mL Eppendorf Safe-Lock tubes prefilled with stabilized ceramic beads. RNase free.

5E PINK RNA Lysis Kit 20
PINK5E20-RNA	Next Advance	20pack	EUR 136
Description: Bead lysis kits for the homogenization of small, soft or medium-tough samples. Pack of 20, 5mL Eppendorf Safe-Lock tubes prefilled with stabilized ceramic beads. RNase free.

Pink RINO RNA Lysis Kit 50
PINKR1-RNA	Next Advance	50pack	EUR 181
Description: Bead lysis kits for the homogenization of small, soft or medium-tough samples. Pack of 50, 1.5mL RINO screw-cap tubes prefilled with stabilized ceramic beads. RNase free.

Pink RINO RNA Lysis Kit 250
PINKR5-RNA	Next Advance	250pack	EUR 576
Description: Bead lysis kits for the homogenization of small, soft or medium-tough samples. Pack of 250, 1.5mL RINO screw-cap tubes prefilled with stabilized ceramic beads. RNase free.

5E RED RNA Lysis Kit 100
RED5E100-RNA	Next Advance	100pack	EUR 429
Description: Bead lysis kits for the homogenization of large, soft or medium-tough samples. Pack of 100, 5mL Eppendorf Safe-Lock tubes prefilled with stabilized ceramic beads. RNase free.

5E RED RNA Lysis Kit 20
RED5E20-RNA	Next Advance	20pack	EUR 148
Description: Bead lysis kits for the homogenization of large, soft or medium-tough samples. Pack of 20, 5mL Eppendorf Safe-Lock tubes prefilled with stabilized ceramic beads. RNase free.

Red RINO RNA Lysis Kit 50
REDR1-RNA	Next Advance	50pack	EUR 195
Description: Bead lysis kits for the homogenization of large, soft or medium-tough samples. Pack of 50, 1.5mL RINO screw-cap tubes prefilled with stabilized ceramic beads. RNase free.

Red RINO RNA Lysis Kit 250
REDR5-RNA	Next Advance	250pack	EUR 638
Description: Bead lysis kits for the homogenization of large, soft or medium-tough samples. Pack of 250, 1.5mL RINO screw-cap tubes prefilled with stabilized ceramic beads. RNase free.

YELLOW RINO RNA Lysis Kit 50
YELLOWR1-RNA	Next Advance	50pack	EUR 199
Description: Bead lysis kits for the homogenization of small cell suspensions (ex - E. coli). Pack of 50, 1.5mL RINO screw-cap tubes prefilled with stabilized ceramic beads. RNase free.

YELLOW RINO RNA Lysis Kit 250
YELLOWR5-RNA	Next Advance	250pack	EUR 656
Description: Bead lysis kits for the homogenization of small cell suspensions (ex - E. coli). Pack of 250, 1.5mL RINO screw-cap tubes prefilled with stabilized ceramic beads. RNase free.

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

Dr. P Kit-Isolation of RNA, DNA and Protein from the same piece of tissue simultaneously
K2021010	Biochain	1 kit	EUR 422
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Kin17 DNA And RNA Binding Protein (KIN) Antibody
20-abx113374	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Kin17 DNA And RNA Binding Protein (KIN) Protein
20-abx260971	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Kin17 DNA And RNA Binding Protein (KIN) Antibody
abx234575-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Exosomal RNA Extraction Kit
P200R,-part-of-P200	101Bio	NULL	EUR 0

100 BP DNA LADDER, 500UL PER KIT
M-DNA-100BP	CORNING	1/pk	EUR 73
Description: Bioscience Mol Bio; DNA Ladder

1 KB DNA LADDER, 500UL PER KIT
M-DNA-1KB	CORNING	1/pk	EUR 70
Description: Bioscience Mol Bio; DNA Ladder

Human Brain Genomic DNA
X11001	EpiGentek	10 µg	Ask for price
Description: kits suitable for this type of research

Total RNA from Rat Normal Tissue: Brain
R1434035-50	Biochain	50 ug	EUR 152
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Viral DNA / RNA Kit
20-abx098090	Abbexa	EUR 105.00 EUR 286.00	2 rxns 50 rxns
Shipped within 5-10 working days.

Viral DNA / RNA Kit
abx098872-50rxns	Abbexa	50 rxns	EUR 370
Shipped within 5-10 working days.

DNA / RNA Damage Antibody
abx440040-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx440321-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx440602-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx440883-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx441164-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx441445-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx441726-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx442007-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx442288-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx442569-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx442850-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx443130-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx443410-100ug	Abbexa	100 ug	EUR 537
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx443691-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx443972-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx444253-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
abx444534-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DNA / RNA Damage Antibody
20-abx444884	Abbexa	EUR 495.00 EUR 328.00	100 ug 25 ug
Shipped within 5-12 working days.

EZBlock? Universal Protease and Phosphatase Inhibitor Cocktail
K283-set	Biovision		EUR 620

MAX LIFE Gene Analyzer - Fluorometer for DNA, RNA and Protein
H100	GeneOn	1 pcs	Ask for price

Human Kin17 DNA And RNA Binding Protein (KIN) ELISA Kit
abx388159-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Genomic DNA from Rat Normal Tissue: Brain
D1434035	Biochain	100 ug	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

EZBlock? Universal Protease and Phosphatase Inhibitor Cocktail , EDTA-Free
K284-set	Biovision		EUR 626

EZCell? Cell Stimulation and Protein Transport Inhibitor Cocktail (500X)
K931-set	Biovision		EUR 370

Total RNA from Rat Normal Tissue: Brain, cerebellum
R1434039-50	Biochain	50 ug	EUR 152
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

ELISA Microplate Washer Automated (#MPW-30) bottle set (3 bottles and cap assembly)
MPW-30-SET	Alpha Diagnostics	1	EUR 408

Human DNA-directed RNA polymerases I and III subunit RPAC2 (POLR1D)
1-CSB-EP897095HU	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 42.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human DNA-directed RNA polymerases I and III subunit RPAC2(POLR1D) expressed in E.coli

NUCLEAZOR, DNA & RNA Decontaminant Spray
N5000-025	GenDepot	250 ml	EUR 135

Human DNA-directed DNA/RNA polymerase mu (POLM)
1-CSB-YP889065HU	Cusabio	EUR 586.00 EUR 299.00 EUR 2172.00 EUR 900.00 EUR 1442.00 EUR 382.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 57.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human DNA-directed DNA/RNA polymerase mu(POLM) expressed in Yeast

Human DNA-directed DNA/RNA polymerase mu (POLM)
1-CSB-EP889065HU	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 58.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human DNA-directed DNA/RNA polymerase mu(POLM) expressed in E.coli

Human DNA-directed DNA/RNA polymerase mu (POLM)
1-CSB-BP889065HU	Cusabio	EUR 840.00 EUR 332.00 EUR 2170.00 EUR 1135.00 EUR 1579.00 EUR 470.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 58.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human DNA-directed DNA/RNA polymerase mu(POLM) expressed in Baculovirus

Recombinant human DNA-directed DNA/RNA polymerase mu
P2815	FN Test	100ug	Ask for price
Uniprot ID: Q9NP87 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human DNA-directed DNA/RNA polymerase mu

Total RNA from Alzheimer's Disease: Brain
R1236035Alz-50	Biochain	50 ug	EUR 351
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Brain and Acute Leukemia, Cytoplamatic
PR27238	Neuromics	2 ug	EUR 191

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC1 (RPAB1) Antibody
20-abx119102	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC1 (POLR2E) Antibody
20-abx114604	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC1 (POLR2E) Antibody
20-abx121663	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC1 (POLR2E) Antibody
20-abx001458	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC3 (RPAB3) Antibody
20-abx149876	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC4 (POLR2K) Antibody
20-abx135780	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC1 (POLR2E) Antibody
abx036186-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC4 (POLR2K) Antibody
20-abx007835	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC1 (POLR2E) Antibody
abx028042-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC1 (POLR2E) Antibody
abx028042-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC2 (RPAB2) Antibody
20-abx217855	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC4 (RPAB4) Antibody
20-abx217857	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC1 (POLR2E) Antibody
20-abx304890	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DNA-Directed RNA Polymerases I, II, And III Subunit RPABC4 (POLR2K) Antibody
20-abx304897	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Rat DNA-directed RNA polymerases I, II, and III subunit RPABC1 (POLR2E)
KTE100871-48T	Abbkine	48T	EUR 332
POLR2E encodes the fifth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA-directed RNA polymerases and is present in two-fold molar excess over Show more
Description: Quantitative sandwich ELISA for measuring Rat DNA-directed RNA polymerases I, II, and III subunit RPABC1 (POLR2E) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat DNA-directed RNA polymerases I, II, and III subunit RPABC1 (POLR2E)
KTE100871-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
POLR2E encodes the fifth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA-directed RNA polymerases and is present in two-fold molar excess over Show more
Description: Quantitative sandwich ELISA for measuring Rat DNA-directed RNA polymerases I, II, and III subunit RPABC1 (POLR2E) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat DNA-directed RNA polymerases I, II, and III subunit RPABC1 (POLR2E)
KTE100871-96T	Abbkine	96T	EUR 539
POLR2E encodes the fifth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA-directed RNA polymerases and is present in two-fold molar excess over Show more
Description: Quantitative sandwich ELISA for measuring Rat DNA-directed RNA polymerases I, II, and III subunit RPABC1 (POLR2E) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ISOLATE II RNA/DNA/Protein Kit
BIO-52085	Bioline	50 preps	Ask for price

ISOLATE II RNA/DNA/Protein Kit
BIO-52085/S	Bioline	Sample	Ask for price

ISOLATE II FFPE RNA/DNA Kit
BIO-52087	Bioline	50 Preps	Ask for price

96-well Viral DNA/RNA Kit
K1417-1	Biovision		EUR 392

96-well Viral DNA/RNA Kit
K1417-4	Biovision		EUR 1023

Monoclonal antibody for DNA/RNA Damage
SMC-155C	Stressmarq	0.025mg	EUR 190
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Dog \| Rabbit DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is not conjugated.

Monoclonal antibody for DNA/RNA Damage
SMC-155D	Stressmarq	0.1mg	EUR 332
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Dog \| Rabbit DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is not conjugated.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-A390	Stressmarq	0.1mg	EUR 379
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Dog \| Rabbit DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with ATTO 390.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-A488	Stressmarq	0.1mg	EUR 378
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with ATTO 488.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-A565	Stressmarq	0.1mg	EUR 378
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with ATTO 565.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-A594	Stressmarq	0.1mg	EUR 378
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with ATTO 594.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-A633	Stressmarq	0.1mg	EUR 378
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with ATTO 633.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-A655	Stressmarq	0.1mg	EUR 378
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with ATTO 655.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-A680	Stressmarq	0.1mg	EUR 378
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with ATTO 680.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-A700	Stressmarq	0.1mg	EUR 378
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with ATTO 700.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-ALP	Stressmarq	0.1mg	EUR 372
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with Alkaline Phosphatase.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-APC	Stressmarq	0.1mg	EUR 377
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with APC.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-APCCY7	Stressmarq	0.1mg	EUR 450
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with APC/Cy7.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-BI	Stressmarq	0.1mg	EUR 374
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with Biotin.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-DY350	Stressmarq	0.1mg	EUR 393
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with Dylight 350.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-DY405	Stressmarq	0.1mg	EUR 381
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with Dylight 405.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-DY488	Stressmarq	0.1mg	EUR 371
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with Dylight 488.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-DY594	Stressmarq	0.1mg	EUR 373
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with Dylight 594.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-DY633	Stressmarq	0.1mg	EUR 368
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with Dylight 633.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-FITC	Stressmarq	0.1mg	EUR 370
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with FITC.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-HRP	Stressmarq	0.1mg	EUR 366
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with HRP.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-P594	Stressmarq	0.1mg	EUR 385
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with PE/ATTO 594.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-PCP	Stressmarq	0.1mg	EUR 377
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with PerCP.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-RPE	Stressmarq	0.1mg	EUR 375
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with RPE.

Monoclonal antibody for DNA/RNA Damage
SMC-155D-STR	Stressmarq	0.1mg	EUR 376
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is conjugated with Streptavidin.

Monoclonal antibody for DNA/RNA Damage
SMC-155S	Stressmarq	0.012mg	EUR 65
DNA or RNA damage is due to environmental factors and normal metabolic processes inside the cell, that then hinder the ability of the cell to carry out its functions. There are four main types of DNA due to endogenous cellular processes and they are Show more
Description: A monoclonal antibody from clone 15A3 against Human \| Mouse \| Rat \| Bovine \| Monkey \| Rabbit \| Pig \| Dog \| Hamster \| Chicken \| Sheep \| Guinea Pig (Cavia porcellus) DNA/RNA Damage. The host species for the production of this antibody is Mouse. The antigen used for immunization is 8-hydroxy-guanosine-BSA and ?casein conjugates. The antibody is tested and validated for IHC, ICC/IF, ELISA, DB, IP, FCM, FA assays with the following recommended dilutions: IHC (1:1000). This MAb for DNA/RNA Damage is not conjugated.

StemBoost? YPAC Cocktail Set (1000X), Sterile-Filtered
K871-set	Biovision		EUR 958

Brain Dissociation System 7 (Endothelial), Mouse and Rat
4-20227	CHI Scientific	ea	Ask for price

The 1982 revised criteria for the classification of systemic lupus erythematosus

The 1971 preliminary criteria for the classification of systemic lupus erythematosus (SLE) were revised and updated to incorporate new immunologic knowledge and improve disease classification. The 1982 revised criteria include fluorescence antinuclear antibody and antibody to native DNA and Sm antigen. Some criteria involving the same organ systems were aggregated into single criteria.

Raynaud’s phenomenon and alopecia were not included in the 1982 revised criteria because of low sensitivity and specificity. The new criteria were 96% sensitive and 96% specific when tested with SLE and control patient data gathered from 18 participating clinics. When compared with the 1971 criteria, the 1982 revised criteria showed gains in sensitivity and specificity.

Translating the histone code

Chromatin, the physiological template of all eukaryotic genetic information, is subject to a diverse array of posttranslational modifications that largely impinge on histone amino termini, thereby regulating access to the underlying DNA. Distinct histone amino-terminal modifications can generate synergistic or antagonistic interaction affinities for chromatin-associated proteins, which in turn dictate dynamic transitions between transcriptionally active or transcriptionally silent chromatin states.

The combinatorial nature of histone amino-terminal modifications thus reveals a “histone code” that considerably extends the information potential of the genetic code. We propose that this epigenetic marking system represents a fundamental regulatory mechanism that has an impact on most, if not all, chromatin-templated processes, with far-reaching consequences for cell fate decisions and both normal and pathological development.

Genomic sequencing

Unique DNA sequences can be determined directly from mouse genomic DNA. A denaturing gel separates by size mixtures of unlabeled DNA fragments from complete restriction and partial chemical cleavages of the entire genome. These lanes of DNA are transferred and UV-crosslinked to nylon membranes. Hybridization with a short 32P-labeled single-stranded probe produces the image of a DNA sequence “ladder” extending from the 3′ or 5′ end of one restriction site in the genome. Numerous different sequences can be obtained from a single membrane by reprobing.

Each band in these sequences represents 3 fg of DNA complementary to the probe. Sequence data from mouse immunoglobulin heavy chain genes from several cell types are presented. The genomic sequencing procedures are applicable to the analysis of genetic polymorphisms, DNA methylation at deoxycytidines, and nucleic acid-protein interactions at single nucleotide resolution.

A new method for sequencing DNA

DNA can be sequenced by a chemical procedure that breaks a terminally labeled DNA molecule partially at each repetition of a base. The lengths of the labeled fragments then identify the positions of that base. We describe reactions that cleave DNA preferentially at guanines, at adenines, at cytosines and thymines equally, and at cytosines alone.

When the products of these four reactions are resolved by size, by electrophoresis on a polyacrylamide gel, the DNA sequence can be read from the pattern of radioactive bands. The technique will permit sequencing of at least 100 bases from the point of labeling.

Genome sequencing in microfabricated high-density picolitre reactors

The proliferation of large-scale DNA-sequencing projects in recent years has driven a search for alternative methods to reduce time and cost. Here we describe a scalable, highly parallel sequencing system with raw throughput significantly greater than that of state-of-the-art capillary electrophoresis instruments. The apparatus uses a novel fibre-optic slide of individual wells and is able to sequence 25 million bases, at 99% or better accuracy, in one four-hour run.

To achieve an approximately 100-fold increase in throughput over current Sanger sequencing technology, we have developed an emulsion method for DNA amplification and an instrument for sequencing by synthesis using a pyrosequencing protocol optimized for solid support and picolitre-scale volumes. Here we show the utility, throughput, accuracy and robustness of this system by shotgun sequencing and de novo assembly of the Mycoplasma genitalium genome with 96% coverage at 99.96% accuracy in one run of the machine.

The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers

A series of plasmid vectors containing the multiple cloning site (MCS7) of M13mp7 has been constructed. In one of these vectors a kanamycin-resistance marker has been inserted into the center of the symmetrical MCS7 to yield a restriction-site-mobilizing element (RSM).

The drug-resistance marker can be cleaved out of this vector with any of the restriction enzymes that recognize a site of the flanking sequences of the RSM to generate an RSM with either various sticky ends or blunt ends. These fragments can be used for insertion mutagenesis of any target molecule with compatible restriction sites. Insertion mutants are selected by their resistance to kanamycin.

When the drug-resistance marker is removed with PstI, a small in-frame insertion can be generated. In addition, two new MCSs having single restriction sites have been formed by altering the symmetrical structure of MCS7. The resulting plasmids pUC8 and pUC9 allow one to clone doubly digested restriction fragments separately with both orientations in respect to the lac promoter. The terminal sequences of any DNA cloned in these plasmids can be characterized using the universal M13 primers.

DNAJB14 antibody
70R-16875	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DNAJB14 antibody

DNAJB14 Antibody
DF12198	Affbiotech	200ul	EUR 304
Description: DNAJB14 antibody detects endogenous levels of DNAJB14.

DNAJB14 Antibody
1-CSB-PA007007GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DNAJB14 Antibody
1-CSB-PA819454LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DNAJB14 Polyclonal Antibody
A66234	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

DNAJB14 Polyclonal Antibody
30628-100ul	SAB	100ul	EUR 252

DNAJB14 Polyclonal Antibody
30628-50ul	SAB	50ul	EUR 187

DNAJB14 siRNA
20-abx914343	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DNAJB14 siRNA
20-abx914344	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DNAJB14 Polyclonal Conjugated Antibody
C30628	SAB	100ul	EUR 397

DNAJB14 Antibody, HRP conjugated
1-CSB-PA819454LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DNAJB14 Antibody, FITC conjugated
1-CSB-PA819454LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DNAJB14 Antibody, Biotin conjugated
1-CSB-PA819454LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DNAJB14 Rabbit pAb
A4990-100ul	Abclonal	100 ul	EUR 308

DNAJB14 Rabbit pAb
A4990-200ul	Abclonal	200 ul	EUR 459

DNAJB14 Rabbit pAb
A4990-20ul	Abclonal	20 ul	EUR 183

DNAJB14 Rabbit pAb
A4990-50ul	Abclonal	50 ul	EUR 223

DNAJB14 Blocking Peptide
DF12198-BP	Affbiotech	1mg	EUR 195

DNAJB14 cloning plasmid
CSB-CL819454HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 1140 Sequence: atggaggggaacagggatgaggctgagaaatgtgtcgagatcgcccgggaggccctgaacgccggcaaccgcgagaaggcccagcgcttcctgcagaaggccgagaagctctacccactgccctcggcccgcgcactattggaaataattatgaaaaatggaagcacggctggaa Show more
Description: A cloning plasmid for the DNAJB14 gene.

DNAJB14 Polyclonal Antibody, HRP Conjugated
A66235	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

DNAJB14 Polyclonal Antibody, FITC Conjugated
A66236	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

DNAJB14 Polyclonal Antibody, Biotin Conjugated
A66237	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

Mouse DNAJB14 shRNA Plasmid
20-abx977260	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human DNAJB14 shRNA Plasmid
20-abx962706	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DNAJB14 ELISA KIT\|Human
EF009156	Lifescience Market	96 Tests	EUR 689

DNAJB14 Recombinant Protein (Human)
RP009529	ABM	100 ug	Ask for price

DNAJB14 Recombinant Protein (Rat)
RP198299	ABM	100 ug	Ask for price

DNAJB14 Recombinant Protein (Mouse)
RP129476	ABM	100 ug	Ask for price

DNAJB14 ORF Vector (Human) (pORF)
ORF003177	ABM	1.0 ug DNA	EUR 95

Dnajb14 ORF Vector (Rat) (pORF)
ORF066101	ABM	1.0 ug DNA	EUR 506

Dnajb14 ORF Vector (Mouse) (pORF)
ORF043160	ABM	1.0 ug DNA	EUR 506

DNAJB14 sgRNA CRISPR Lentivector set (Human)
K0614501	ABM	3 x 1.0 ug	EUR 339

Dnajb14 sgRNA CRISPR Lentivector set (Mouse)
K4586901	ABM	3 x 1.0 ug	EUR 339

Dnajb14 sgRNA CRISPR Lentivector set (Rat)
K6216401	ABM	3 x 1.0 ug	EUR 339

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
20-abx112129	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
20-abx003806	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
20-abx302018	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
abx232446-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 1)
K0614502	ABM	1.0 ug DNA	EUR 154

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 2)
K0614503	ABM	1.0 ug DNA	EUR 154

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 3)
K0614504	ABM	1.0 ug DNA	EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4586902	ABM	1.0 ug DNA	EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4586903	ABM	1.0 ug DNA	EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4586904	ABM	1.0 ug DNA	EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6216402	ABM	1.0 ug DNA	EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6216403	ABM	1.0 ug DNA	EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6216404	ABM	1.0 ug DNA	EUR 154

DNAJB14 Protein Vector (Mouse) (pPB-C-His)
PV172638	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Mouse) (pPB-N-His)
PV172639	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Mouse) (pPM-C-HA)
PV172640	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Mouse) (pPM-C-His)
PV172641	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Human) (pPB-C-His)
PV012705	ABM	500 ng	EUR 329

DNAJB14 Protein Vector (Human) (pPB-N-His)
PV012706	ABM	500 ng	EUR 329

DNAJB14 Protein Vector (Human) (pPM-C-HA)
PV012707	ABM	500 ng	EUR 329

DNAJB14 Protein Vector (Human) (pPM-C-His)
PV012708	ABM	500 ng	EUR 329

DNAJB14 Protein Vector (Rat) (pPB-C-His)
PV264402	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Rat) (pPB-N-His)
PV264403	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Rat) (pPM-C-HA)
PV264404	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Rat) (pPM-C-His)
PV264405	ABM	500 ng	EUR 603

Dnajb14 3'UTR Luciferase Stable Cell Line
TU203509	ABM	1.0 ml	Ask for price

Dnajb14 3'UTR GFP Stable Cell Line
TU155250	ABM	1.0 ml	Ask for price

DNAJB14 3'UTR Luciferase Stable Cell Line
TU006138	ABM	1.0 ml	EUR 2333

Dnajb14 3'UTR Luciferase Stable Cell Line
TU105250	ABM	1.0 ml	Ask for price

DNAJB14 3'UTR GFP Stable Cell Line
TU056138	ABM	1.0 ml	EUR 2333

Dnajb14 3'UTR GFP Stable Cell Line
TU253509	ABM	1.0 ml	Ask for price

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (HRP)
20-abx308795	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (FITC)
20-abx308796	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (Biotin)
20-abx308797	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human DnaJ homolog subfamily B member 14, DNAJB14 ELISA KIT
ELI-26399h	Lifescience Market	96 Tests	EUR 824

Mouse DnaJ homolog subfamily B member 14, Dnajb14 ELISA KIT
ELI-08275m	Lifescience Market	96 Tests	EUR 865

Bovine DnaJ homolog subfamily B member 14, DNAJB14 ELISA KIT
ELI-31942b	Lifescience Market	96 Tests	EUR 928

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0614505	ABM	3 x 1.0 ug	EUR 376

Human DnaJ Homolog Subfamily B Member 14 (DNAJB14) ELISA Kit
abx386930-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4586905	ABM	3 x 1.0 ug	EUR 376

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6216405	ABM	3 x 1.0 ug	EUR 376

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0614506	ABM	1.0 ug DNA	EUR 167

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0614507	ABM	1.0 ug DNA	EUR 167

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0614508	ABM	1.0 ug DNA	EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4586906	ABM	1.0 ug DNA	EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4586907	ABM	1.0 ug DNA	EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4586908	ABM	1.0 ug DNA	EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6216406	ABM	1.0 ug DNA	EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6216407	ABM	1.0 ug DNA	EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6216408	ABM	1.0 ug DNA	EUR 167

Anti-Anti-SEPT2 Antibody antibody
STJ28365	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT7 Antibody antibody
STJ28963	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody
STJ11100949	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody
STJ25475	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ25477	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody
STJ25479	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody
STJ111369	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody
STJ111530	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT4 Antibody antibody
STJ112276	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody
STJ112609	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT11 Antibody antibody
STJ113941	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT11 Antibody antibody
STJ114081	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ114819	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody
STJ114828	St John's Laboratory	100 µl	EUR 277

Anti-Anti-MARCH6 Antibody antibody
STJ118549	St John's Laboratory	100 µl	EUR 277

Anti-Anti-MARCH6 Antibody antibody
STJ118550	St John's Laboratory	100 µl	EUR 277

Anti-Anti-MARCH7 Antibody antibody
STJ118752	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT3 Antibody antibody
STJ118990	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT1 antibody antibody
STJ119580	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-SEPT7 Antibody antibody
STJ116214	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody
STJ117206	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody
STJ117759	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-DDB1 Antibody
A00333	BosterBio	100uL	EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
4-AEA465Hu	Cloud-Clone	EUR 5698.00 EUR 3011.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies Sperm Antibodies Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)
ELK8071	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-HAMA Antibody
E61I006	EnoGene	1mg	EUR 349

anti- ASH2L antibody
FNab00637	FN Test	100µg	EUR 505.25
Immunogen: ash2(absent, small, or homeotic)-like(Drosophila) Uniprot ID: Q9UBL3 Gene ID: 9070 Research Area: Epigenetics, Metabolism
Description: Antibody raised against ASH2L

anti- ASIC2 antibody
FNab00638	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:1000 Immunogen: amiloride-sensitive cation channel 1, neuronal Uniprot ID: Q16515 Gene ID: 40 Research Area: Neuroscience
Description: Antibody raised against ASIC2

anti- ASIC4 antibody
FNab00639	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:1000 Immunogen: amiloride-sensitive cation channel 4, pituitary Uniprot ID: Q96FT7 Gene ID: 55515 Research Area: Neuroscience
Description: Antibody raised against ASIC4

anti- ASK1 antibody
FNab00640	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:100-1:1000 Immunogen: mitogen-activated protein kinase kinase kinase 5 Uniprot ID: Q99683 Gene ID: 4217 Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ASK1

anti- ASL antibody
FNab00641	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:1000 IHC: 1:100-1:500 Immunogen: argininosuccinate lyase Uniprot ID: P04424 Gene ID: 435 Research Area: Metabolism
Description: Antibody raised against ASL

anti- ASMTL antibody
FNab00642	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IP: 1:50 - 1:200 Immunogen: acetylserotonin O-methyltransferase-like Uniprot ID: O95671 Gene ID: 8623 Research Area: Metabolism
Description: Antibody raised against ASMTL

anti- ASNA1 antibody
FNab00643	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200 - 1:2000 IHC: 1:50 - 1:200 Immunogen: arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) Uniprot ID: O43681 Gene ID: 439 Research Area: Metabolism
Description: Antibody raised against ASNA1

anti- ASNS antibody
FNab00644	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:1000 Immunogen: asparagine synthetase Uniprot ID: P08243 Gene ID: 440 Research Area: Metabolism
Description: Antibody raised against ASNS

anti- ASPA antibody
FNab00645	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IHC: 1:50-1:500 Immunogen: aspartoacylase(Canavan disease) Uniprot ID: P45381 Gene ID: 443 Research Area: Metabolism
Description: Antibody raised against ASPA

anti- ASPH antibody
FNab00646	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IHC: 1:50-1:500 Immunogen: aspartate beta-hydroxylase Uniprot ID: Q12797 Gene ID: 444 Research Area: Neuroscience, Metabolism
Description: Antibody raised against ASPH

anti- ASPRV1 antibody
FNab00647	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 Immunogen: aspartic peptidase, retroviral-like 1 Uniprot ID: Q53RT3 Gene ID: 151516 Research Area: Metabolism
Description: Antibody raised against ASPRV1

anti- ASRGL1 antibody
FNab00648	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:1000 IHC: 1:20-1:200 IF: 1:50-1:500 Immunogen: asparaginase like 1 Uniprot ID: Q7L266 Gene ID: 80150 Research Area: Metabolism
Description: Antibody raised against ASRGL1

anti- ASS1 antibody
FNab00649	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:1000-1:6000 IP: 1:500-1:3000 IHC: 1:50-1:500 IF: 1:50-1:500 Immunogen: argininosuccinate synthetase 1 Uniprot ID: P00966 Gene ID: 445 Research Area: Metabolism
Description: Antibody raised against ASS1

anti- ASS1 antibody
FNab00650	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:1000-1:4000 IHC: 1:100-1:500 IF: 1:20-1:100 Immunogen: argininosuccinate synthetase 1 Uniprot ID: P00966 Gene ID: 445 Research Area: Metabolism
Description: Antibody raised against ASS1

anti- ASTL antibody
FNab00651	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 Immunogen: astacin-like metallo-endopeptidase(M12 family) Uniprot ID: Q6HA08 Gene ID: 431705 Research Area: Stem Cells, Metabolism
Description: Antibody raised against ASTL

anti- ASTN2 antibody
FNab00652	FN Test	100µg	EUR 505.25
Immunogen: astrotactin 2 Uniprot ID: O75129 Gene ID: 23245 Research Area: Metabolism
Description: Antibody raised against ASTN2

anti- ASZ1 antibody
FNab00653	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 Immunogen: ankyrin repeat, SAM and basic leucine zipper domain containing 1 Uniprot ID: Q8WWH4 Gene ID: 136991 Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against ASZ1

anti- ATAD1 antibody
FNab00654	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:1000 IP: 1:200-1:1000 Immunogen: ATPase family, AAA domain containing 1 Uniprot ID: Q8NBU5 Gene ID: 84896 Research Area: Metabolism
Description: Antibody raised against ATAD1

anti- ATAD2 antibody
FNab00655	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 Immunogen: ATPase family, AAA domain containing 2 Uniprot ID: Q6PL18 Gene ID: 29028 Research Area: Metabolism
Description: Antibody raised against ATAD2

anti- ATAD5 antibody
FNab00656	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 Immunogen: ATPase family, AAA domain containing 5 Uniprot ID: Q96QE3 Gene ID: 79915 Research Area: Metabolism
Description: Antibody raised against ATAD5

anti- ATE1 antibody
FNab00658	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 Immunogen: arginyltransferase 1 Uniprot ID: O95260 Gene ID: 11101 Research Area: Metabolism
Description: Antibody raised against ATE1

anti- ATF1 antibody
FNab00659	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 Immunogen: activating transcription factor 1 Uniprot ID: P18846 Gene ID: 466 Research Area: Epigenetics, Metabolism
Description: Antibody raised against ATF1

anti- ATF2 antibody
FNab00660	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: activating transcription factor 2 Uniprot ID: P15336 Gene ID: 1386 Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Immunology
Description: Antibody raised against ATF2

anti- ATF4 antibody
FNab00662	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IP: 1:200-1:1000 IHC: 1:50-1:500 IF: 1:50-1:500 Immunogen: activating transcription factor 4(tax-responsive enhancer element B67) Uniprot ID: P18848 Gene ID: 468 Research Area: Neuroscience, Epigenetics, Meta Show more
Description: Antibody raised against ATF4

anti- ATF4 antibody
FNab00663	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:1000-1:2000 IHC: 1:50-1:300 IF: 1:20-1:100 Immunogen: activating transcription factor 4(tax-responsive enhancer element B67) Uniprot ID: P18848 Gene ID: 468 Research Area: Neuroscience, Epigenetics, Metabolism, Developme Show more
Description: Antibody raised against ATF4

anti- ATF6 antibody
FNab00664	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:2000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: activating transcription factor 6 Uniprot ID: P18850 Gene ID: 22926 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ATF6

anti- ATF6B antibody
FNab00665	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:1000-1:4000 IP:1:500-1:2000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: activating transcription factor 6 beta Uniprot ID: Q99941 Gene ID: 1388 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ATF6B

anti- ATG12 antibody
FNab00666	FN Test	100µg	EUR 548.75
Immunogen: ATG12 autophagy related 12 homolog(S. cerevisiae) Uniprot ID: O94817 Gene ID: 9140 Research Area: Epigenetics, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG12

Tags: antigenes, bromides, enzymes, microRNA, Secondairy, Vector

NorDiag Biotech Plasmid and DNA purification