Integrated genomic analyses of ovarian carcinoma

A catalogue of molecular aberrations that cause ovarian cancer is critical for developing and deploying therapies that will improve patients’ lives. The Cancer Genome Atlas project has analysed messenger RNA expression, microRNA expression, promoter methylation and DNA copy number in 489 high-grade serous ovarian adenocarcinomas and the DNA sequences of exons from coding genes in 316 of these tumours. Here we report that high-grade serous ovarian cancer is characterized by TP53 mutations in almost all tumours (96%); low prevalence but statistically recurrent somatic mutations in nine further genes including NF1, BRCA1, BRCA2, RB1 and CDK12; 113 significant focal DNA copy number aberrations; and promoter methylation events involving 168 genes.

Analyses delineated four ovarian cancer transcriptional subtypes, three microRNA subtypes, four promoter methylation subtypes and a transcriptional signature associated with survival duration, and shed new light on the impact that tumours with BRCA1/2 (BRCA1 or BRCA2) and CCNE1 aberrations have on survival. Pathway analyses suggested that homologous recombination is defective in about half of the tumours analysed, and that NOTCH and FOXM1 signalling are involved in serous ovarian cancer pathophysiology.

Rapid isolation of high molecular weight plant DNA.

A method is presented for the rapid isolation of high molecular weight plant DNA (50,000 base pairs or more in length) which is free of contaminants which interfere with complete digestion by restriction endonucleases. The procedure yields total cellular DNA (i.e. nuclear, chloroplast, and mitochondrial DNA). The technique is ideal for the rapid isolation of small amounts of DNA from many different species and is also useful for large scale isolations.

Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.

Construction and characterization of a class of multicopy plasmid cloning vehicles containing the replication system of miniplasmid P15A are described. The constructed plasmids have cleavage sites within antibiotic resistance genes for a variety of commonly employed site-specific endonucleases, permitting convenient use of the insertional inactivation procedure for the selection of clones that contain hybrid DNA molecules.

Although the constructed plasmids showed DNA sequence homology with the ColE1 plasmid within the replication region, were amplifiable by chloramphenicol or spectinomycin, required DNA polymerase I for replication, and shared other replication properties with ColE1, they were nevertheless compatible with ColE1. P15A-derived plasmids were not self-transmissible and were mobilized poorly by Hfr strains; however, mobilization was complemented by the presence of a ColE1 plasmid within the same cell.

Genome-wide insertional mutagenesis of Arabidopsis thaliana

Over 225,000 independent Agrobacterium transferred DNA (T-DNA) insertion events in the genome of the reference plant Arabidopsis thaliana have been created that represent near saturation of the gene space. The precise locations were determined for more than 88,000 T-DNA insertions, which resulted in the identification of mutations in more than 21,700 of the approximately 29,454 predicted Arabidopsis genes.

Genome-wide analysis of the distribution of integration events revealed the existence of a large integration site bias at both the chromosome and gene levels. Insertion mutations were identified in genes that are regulated in response to the plant hormone ethylene.

Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1

The Cancer Genome Atlas Network recently cataloged recurrent genomic abnormalities in glioblastoma multiforme (GBM). We describe a robust gene expression-based molecular classification of GBM into Proneural, Neural, Classical, and Mesenchymal subtypes and integrate multidimensional genomic data to establish patterns of somatic mutations and DNA copy number. Aberrations and gene expression of EGFR, NF1, and PDGFRA/IDH1 each define the Classical, Mesenchymal, and Proneural subtypes, respectively.

Gene signatures of normal brain cell types show a strong relationship between subtypes and different neural lineages. Additionally, response to aggressive therapy differs by subtype, with the greatest benefit in the Classical subtype and no benefit in the Proneural subtype. We provide a framework that unifies transcriptomic and genomic dimensions for GBM molecular stratification with important implications for future studies.

The International HapMap Project.

The goal of the International HapMap Project is to determine the common patterns of DNA sequence variation in the human genome and to make this information freely available in the public domain.

An international consortium is developing a map of these patterns across the genome by determining the genotypes of one million or more sequence variants, their frequencies and the degree of association between them, in DNA samples from populations with ancestry from parts of Africa, Asia and Europe. The HapMap will allow the discovery of sequence variants that affect common disease, will facilitate development of diagnostic tools, and will enhance our ability to choose targets for therapeutic intervention.

Sequence and organization of the human mitochondrial genome

The complete sequence of the 16,569-base pair human mitochondrial genome is presented. The genes for the 12S and 16S rRNAs, 22 tRNAs, cytochrome c oxidase subunits I, II and III, ATPase subunit 6, cytochrome b and eight other predicted protein coding genes have been located. The sequence shows extreme economy in that the genes have none or only a few noncoding bases between them, and in many cases the termination codons are not coded in the DNA but are created post-transcriptionally by polyadenylation of the mRNAs.

Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences.

In 2001 and 2002, we published two papers (Bioinformatics, 17, 282-283, Bioinformatics, 18, 77-82) describing an ultrafast protein sequence clustering program called cd-hit.

This program can efficiently cluster a huge protein database with millions of sequences. However, the applications of the underlying algorithm are not limited to only protein sequences clustering, here we present several new programs using the same algorithm including cd-hit-2d, cd-hit-est and cd-hit-est-2d. Cd-hit-2d compares two protein datasets and reports similar matches between them; cd-hit-est clusters a DNA/RNA sequence database and cd-hit-est-2d compares two nucleotide datasets

. All these programs can handle huge datasets with millions of sequences and can be hundreds of times faster than methods based on the popular sequence comparison and database search tools, such as BLAST.

DNAJB14 antibody
70R-16875	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DNAJB14 antibody

DNAJB14 Antibody
1-CSB-PA819454LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DNAJB14 Antibody
DF12198	Affbiotech	200ul	EUR 304
Description: DNAJB14 antibody detects endogenous levels of DNAJB14.

DNAJB14 Antibody
1-CSB-PA007007GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DNAJB14 Polyclonal Antibody
30628-100ul	SAB	100ul	EUR 252

DNAJB14 Polyclonal Antibody
30628-50ul	SAB	50ul	EUR 187

DNAJB14 Polyclonal Antibody
A66234	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

DNAJB14 siRNA
20-abx914343	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DNAJB14 siRNA
20-abx914344	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DNAJB14 Antibody, HRP conjugated
1-CSB-PA819454LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DNAJB14 Antibody, FITC conjugated
1-CSB-PA819454LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DNAJB14 Antibody, Biotin conjugated
1-CSB-PA819454LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DNAJB14 Polyclonal Conjugated Antibody
C30628	SAB	100ul	EUR 397

DNAJB14 Blocking Peptide
DF12198-BP	Affbiotech	1mg	EUR 195

DNAJB14 cloning plasmid
CSB-CL819454HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 1140 Sequence: atggaggggaacagggatgaggctgagaaatgtgtcgagatcgcccgggaggccctgaacgccggcaaccgcgagaaggcccagcgcttcctgcagaaggccgagaagctctacccactgccctcggcccgcgcactattggaaataattatgaaaaatggaagcacggctggaa Show more
Description: A cloning plasmid for the DNAJB14 gene.

DNAJB14 Rabbit pAb
A4990-100ul	Abclonal	100 ul	EUR 308

DNAJB14 Rabbit pAb
A4990-200ul	Abclonal	200 ul	EUR 459

DNAJB14 Rabbit pAb
A4990-20ul	Abclonal	20 ul	EUR 183

DNAJB14 Rabbit pAb
A4990-50ul	Abclonal	50 ul	EUR 223

DNAJB14 Polyclonal Antibody, HRP Conjugated
A66235	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

DNAJB14 Polyclonal Antibody, FITC Conjugated
A66236	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

DNAJB14 Polyclonal Antibody, Biotin Conjugated
A66237	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

DNAJB14 ELISA KIT\|Human
EF009156	Lifescience Market	96 Tests	EUR 689

Mouse DNAJB14 shRNA Plasmid
20-abx977260	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human DNAJB14 shRNA Plasmid
20-abx962706	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DNAJB14 Recombinant Protein (Human)
RP009529	ABM	100 ug	Ask for price

DNAJB14 Recombinant Protein (Rat)
RP198299	ABM	100 ug	Ask for price

DNAJB14 Recombinant Protein (Mouse)
RP129476	ABM	100 ug	Ask for price

Dnajb14 ORF Vector (Rat) (pORF)
ORF066101	ABM	1.0 ug DNA	EUR 506

DNAJB14 ORF Vector (Human) (pORF)
ORF003177	ABM	1.0 ug DNA	EUR 95

Dnajb14 ORF Vector (Mouse) (pORF)
ORF043160	ABM	1.0 ug DNA	EUR 506

DNAJB14 sgRNA CRISPR Lentivector set (Human)
K0614501	ABM	3 x 1.0 ug	EUR 339

Dnajb14 sgRNA CRISPR Lentivector set (Rat)
K6216401	ABM	3 x 1.0 ug	EUR 339

Dnajb14 sgRNA CRISPR Lentivector set (Mouse)
K4586901	ABM	3 x 1.0 ug	EUR 339

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
20-abx003806	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
20-abx112129	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
20-abx302018	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
abx232446-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 1)
K0614502	ABM	1.0 ug DNA	EUR 154

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 2)
K0614503	ABM	1.0 ug DNA	EUR 154

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 3)
K0614504	ABM	1.0 ug DNA	EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6216402	ABM	1.0 ug DNA	EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6216403	ABM	1.0 ug DNA	EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6216404	ABM	1.0 ug DNA	EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4586902	ABM	1.0 ug DNA	EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4586903	ABM	1.0 ug DNA	EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4586904	ABM	1.0 ug DNA	EUR 154

DNAJB14 Protein Vector (Mouse) (pPB-C-His)
PV172638	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Mouse) (pPB-N-His)
PV172639	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Mouse) (pPM-C-HA)
PV172640	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Mouse) (pPM-C-His)
PV172641	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Rat) (pPB-C-His)
PV264402	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Rat) (pPB-N-His)
PV264403	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Rat) (pPM-C-HA)
PV264404	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Rat) (pPM-C-His)
PV264405	ABM	500 ng	EUR 603

DNAJB14 Protein Vector (Human) (pPB-C-His)
PV012705	ABM	500 ng	EUR 329

DNAJB14 Protein Vector (Human) (pPB-N-His)
PV012706	ABM	500 ng	EUR 329

DNAJB14 Protein Vector (Human) (pPM-C-HA)
PV012707	ABM	500 ng	EUR 329

DNAJB14 Protein Vector (Human) (pPM-C-His)
PV012708	ABM	500 ng	EUR 329

Dnajb14 3'UTR GFP Stable Cell Line
TU155250	ABM	1.0 ml	Ask for price

Dnajb14 3'UTR Luciferase Stable Cell Line
TU105250	ABM	1.0 ml	Ask for price

Dnajb14 3'UTR Luciferase Stable Cell Line
TU203509	ABM	1.0 ml	Ask for price

Dnajb14 3'UTR GFP Stable Cell Line
TU253509	ABM	1.0 ml	Ask for price

DNAJB14 3'UTR GFP Stable Cell Line
TU056138	ABM	1.0 ml	EUR 2333

DNAJB14 3'UTR Luciferase Stable Cell Line
TU006138	ABM	1.0 ml	EUR 2333

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (HRP)
20-abx308795	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (FITC)
20-abx308796	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (Biotin)
20-abx308797	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human DnaJ homolog subfamily B member 14, DNAJB14 ELISA KIT
ELI-26399h	Lifescience Market	96 Tests	EUR 824

Mouse DnaJ homolog subfamily B member 14, Dnajb14 ELISA KIT
ELI-08275m	Lifescience Market	96 Tests	EUR 865

Human DnaJ Homolog Subfamily B Member 14 (DNAJB14) ELISA Kit
abx386930-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Bovine DnaJ homolog subfamily B member 14, DNAJB14 ELISA KIT
ELI-31942b	Lifescience Market	96 Tests	EUR 928

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0614505	ABM	3 x 1.0 ug	EUR 376

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6216405	ABM	3 x 1.0 ug	EUR 376

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4586905	ABM	3 x 1.0 ug	EUR 376

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0614506	ABM	1.0 ug DNA	EUR 167

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0614507	ABM	1.0 ug DNA	EUR 167

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0614508	ABM	1.0 ug DNA	EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6216406	ABM	1.0 ug DNA	EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6216407	ABM	1.0 ug DNA	EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6216408	ABM	1.0 ug DNA	EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4586906	ABM	1.0 ug DNA	EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4586907	ABM	1.0 ug DNA	EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4586908	ABM	1.0 ug DNA	EUR 167

Anti-Anti-SEPT6 antibody antibody
STJ11100949	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody
STJ111369	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody
STJ111530	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT4 Antibody antibody
STJ112276	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody
STJ25475	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ25477	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody
STJ25479	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody
STJ28365	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT7 Antibody antibody
STJ28963	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody
STJ112609	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT11 Antibody antibody
STJ113941	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT11 Antibody antibody
STJ114081	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ114819	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody
STJ114828	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT7 Antibody antibody
STJ116214	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody
STJ117206	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody
STJ117759	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody
STJ118549	St John's Laboratory	100 µl	EUR 277

Anti-Anti-MARCH6 Antibody antibody
STJ118550	St John's Laboratory	100 µl	EUR 277

Anti-Anti-MARCH7 Antibody antibody
STJ118752	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT3 Antibody antibody
STJ118990	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT1 antibody antibody
STJ119580	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-DDB1 Antibody
A00333	BosterBio	100uL	EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
4-AEA465Hu	Cloud-Clone	EUR 5698.00 EUR 3011.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies Sperm Antibodies Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)
ELK8071	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-CYFIP2 Antibody
A06562	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-GPS2 Antibody
A06569	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.

Anti-PRKX Antibody
A06585-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PPA2 Antibody
A06587	BosterBio	100ug/vial	EUR 294

Anti-GluR8 Antibody
A06589	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-EDG7 Antibody
A06597-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-KIR2.3 Antibody
A06605-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for KIR2.3 Antibody (KCNJ4) detection. Tested with WB in Human, Mouse, Rat.

Anti-GALK1 Antibody
A06627	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PRAME Antibody
A06628-2	BosterBio	100ug/vial	EUR 294

Anti-GP2 Antibody
A06630-1	BosterBio	100ug/vial	EUR 334

Anti-USP21 Antibody
A06639	BosterBio	100ug/200ul	EUR 397
Description: Goat Polyclonal USP21 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TLK2 Antibody
A06645	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for TLK2 Antibody (TLK2) detection. Tested with WB in Human, Mouse.

Anti-PPP1R3C Antibody
A06658	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal PPP1R3C Antibody. Validated in WB and tested in Human.

Anti-LRRK1 Antibody
A06670	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal LRRK1 Antibody. Validated in IF, IHC and tested in Human.

Anti-MNDA Antibody
A06675	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human.

Anti-KAL1 Antibody
A06684	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal KAL1 Antibody. Validated in WB and tested in Human.

Anti-COL14A1 Antibody
A06685	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for COL14A1 Antibody (COL14A1) detection.tested for IHC in Human, Mouse, Rat.

Anti-CYP4B1 Antibody
A06690	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for CYP4B1 Antibody (CYP4B1) detection.tested for WB in Human.

Anti-RFX2 Antibody
A06709	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal RFX2 Antibody. Validated in IHC and tested in Human.

Anti-GPR92 Antibody
A06721	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for GPR92 Antibody (LPAR5) detection. Tested for WB, IHC, IF in Human.

Anti-MBTPS1 Antibody
A06735	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal MBTPS1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PLA2G1B Antibody
A06738	BosterBio	100ug/200ul	EUR 397
Description: Goat Polyclonal PLA2G1B Antibody. Validated in WB and tested in Human.

Anti-GNB5 Antibody
A06754	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GNB5 Antibody. Validated in IHC, WB and tested in Human.

Anti-BAIAP2L1 Antibody
A06770	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal BAIAP2L1 Antibody. Validated in WB and tested in Human.

Anti-IRTKS Antibody
A06770-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for IRTKS Antibody (BAIAP2L1) detection.tested for WB in Human, Mouse, Rat.

Anti-MLF1 Antibody
A06772	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal MLF1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-NDR2 Antibody
A06774	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for NDR2 Antibody (STK38L) detection.tested for WB in Human, Mouse, Rat.

Anti-LARG Antibody
A06802-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for LARG Antibody (ARHGEF12) detection. Tested with WB in Human, Mouse, Rat.

Anti-GAS1 Antibody
A06815-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GAS1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-APLF Antibody
A06828-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for APLF Antibody (APLF) detection.tested for WB in Human, Mouse.

Anti-PKCB1 Antibody
A06830	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal PKCB1 Antibody. Validated in WB and tested in Human.

Anti-DnaJB4 Antibody
A06835-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for DnaJB4 Antibody (DNAJB4) detection.tested for WB in Human, Mouse, Rat.

Anti-ArfGAP3 Antibody
A06839	BosterBio	100uL	EUR 455
Description: Rabbit Polyclonal ArfGAP3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-SCN2B Antibody
A06842	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal SCN2B Antibody. Validated in WB and tested in Human.

Anti-CD316 Antibody
A06844	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for CD316 Antibody (IGSF8) detection. Tested with WB in Human, Mouse.

Anti-AMOTL2 Antibody
A06852	BosterBio	100ug/vial	EUR 294

Anti-POM121 Antibody
A06856	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TBX22 Antibody
A06861	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal TBX22 Antibody. Validated in WB and tested in Human.

Anti-QORX Antibody
A06870	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal QORX Antibody. Validated in WB and tested in Human.

Anti-ADAM28 Antibody
A06873-1	BosterBio	100ug/vial	EUR 294

Anti-Adam28 Antibody
A06873-2	BosterBio	100ug/vial	EUR 334

Anti-KSR2 Antibody
A06876	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal KSR2 Antibody. Validated in IF, WB and tested in Human, Mouse.

Tags: antigenes, bromides, enzymes, Isotype, Lenti, Medium, microRNA, Monoclonal, pcr, Polyclonal, Recombinant, rna, Secondairy, Serum, Tag, Vector

NorDiag Biotech Plasmid and DNA purification